<html>
<head>
<meta http-equiv="content-type" content="text/html; charset=ISO-8859-1">
</head>
<body bgcolor="#FFFFFF" text="#000066">
Dear all,<br>
<br>
I'm trying to translate the HGVS data I'm getting in my annotations
with the Ensembl Database to VCF format, so that I can assign a VCF
alternative allele to a Ensembl annotated consequence. Please
consider the following example:<br>
<br>
chr1 154164465 . C <b>A,G</b> 0.04 SNP_AF
AC=1,1;AF=0.125,0.125;AN=8;BaseQRankSum=-0.769;DP=34;Dels=0.0;FS=0.0;HaplotypeScore=0.0;MLEAC=1,1;MLEAF=0.125,0.125;MQ=60.0;MQ0=0;MQRankSum=-0.329;QD=0.0;ReadPosRankSum=0.256;SDP=11;SFREQ=0.111;set=FilteredInAll;CSQ=<b>TPM3|ENSG00000143549|tropomyosin_3|</b><b>ENST00000515609.1:c.30G>T</b>||2/3|ENSP00000426306.1:p.Gln10His|missense_variant|||||||||||Transcript|ENST00000515609||||3.270|24|deleterious(0.798)|deleterious(0)|possibly_damaging(0.896)|Coiled-coils_(Ncoils):ncoils|||||TCAGCTTGCTCTGCCCGATCCAGAGCATTCTCCTTGTCTAACTTCAGCAT[C/A&G]TGCATCTTTTTCTTGATGGCCTCCATCATGAGCAGTGGCTGTTGGTAGGC
GT:AD:DP:FREQ:GQ:PL 0/2:8,0,1:9:0,0.111:10:10,34,307,0,273,270
0/0:4,0,0:4:0,0:12:0,12,150,12,150,150
0/1:9,1,0:10:0.1,0:11:11,0,287,36,290,326
0/0:11,0,0:11:0,0:30:0,30,398,30,398,398<br>
<br>
From the HGVS data (<b>ENST00000515609.1:c.30G>T</b>) I can use
existent hgvs code libraries for obtaining the corresponding
VCF-formatted variant (<b>chr1 154164465 C > A</b>), and thus
being able to select the alternative allele (<b>A</b>) relative to
the consequence. The problem I'm finding here, is that I need to
retrieve the gene set information, also including transcript
versions (ENST00000515609<b>.1</b>) since different versions may
yield different results in the transformation from transcript
coordinates to genomic coordinates. The only resource I've found in
Ensembl is the gene set in .gtf format (<a
href="ftp://ftp.ensembl.org/pub/release-74/gtf/homo_sapiens/Homo_sapiens.GRCh37.74.gtf.gz">ftp://ftp.ensembl.org/pub/release-74/gtf/homo_sapiens/Homo_sapiens.GRCh37.74.gtf.gz</a>),
but no transcript information is available in this file. Is there
any other file containing this information (genePred or RefFlat, for
example)?? Any other hints??<br>
<br>
Thank you in advance,
<div class="moz-signature">-- <br>
<title>Guillermo Marco Puche</title>
<div align="center">
<hr align="center" size="2" width="100%"> </div>
<table cellpadding="0" align="center" border="0">
<tbody>
<tr>
<td>
<p> <span style="font-size:12px;">Guillermo Marco Puche<br>
Bioinformatician, Computer Science Engineer.<br>
Sistemas Genómicos S.L.<br>
Phone: +34 902 364 669<br>
Fax: +34 902 364 670<br>
<a href="www.sistemasgenomicos.com" target="_blank">www.sistemasgenomicos.com</a></span><span
style="font-size:11px;"></span></p>
</td>
<td>
<p> <span style="font-size:10px;"><a
href="https://www.sistemasgenomicos.com/web_sg/web/areas-bioinformatica.php"> <img
alt=""
src="cid:part3.03010603.00010204@sistemasgenomicos.com"
style="height: 100px; width: 250px;"> </a></span></p>
</td>
</tr>
</tbody>
</table>
<div align="center">
<hr align="center" size="2" width="100%"> </div>
</div>
</body>
</html>