<html><head><meta http-equiv="Content-Type" content="text/html charset=us-ascii"></head><body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space;" class="">Hi Will, VEP folk,<div class=""><br class=""></div><div class="">Unfortunately, allele representation has bit us once again. We have the following variant:</div><div class=""><br class=""></div><div class="">1 3394415 . CGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT TGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT,C 9533.30 PASS</div><div class=""><br class=""></div><div class="">Which is really a SNV that overlaps a larger deletion. VEP reads this as CGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT-> TGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT and since that sequence overlaps a splice acceptor (e.g. ENST00000378373), it marks it as a splice_acceptor_variant (even though it doesn't change the acceptor site - just tried VEP v79 on GRCh37 and same issue). Ideally, we'd put this through minimal representation (as we have implemented here: <a href="https://github.com/ericminikel/minimal_representation" class="">https://github.com/ericminikel/minimal_representation</a> which nicely cuts the alleles down), but unfortunately inside a multi-sample VCF, this doesn't really work. Is there a way for this to happen inside VEP/is there a fix to this?<br class=""><div apple-content-edited="true" class="">
<div style="color: rgb(0, 0, 0); letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space;" class=""><div style="color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class=""><br class=""></div><div style="color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">Thanks!<br class="Apple-interchange-newline">-Konrad</div></div></div></div></body></html>