<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=us-ascii">
</head>
<body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space;" class="">
Hi Sarah,
<div class=""><br class="">
</div>
<div class="">Thank you for fixing this. I updated my code and it runs successfully now.</div>
<div class=""><br class="">
</div>
<div class="">Cheers,</div>
<div class="">Bhavana</div>
<div class=""><br class="">
<div>
<blockquote type="cite" class="">
<div class="">On 20 Sep 2016, at 11:16, <a href="mailto:dev-request@ensembl.org" class="">
dev-request@ensembl.org</a> wrote:</div>
<br class="Apple-interchange-newline">
<div class=""><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Message:
1</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Date:
Mon, 19 Sep 2016 14:31:01 +0100</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">From:
Sarah Hunt <</span><a href="mailto:seh@ebi.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">seh@ebi.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Subject:
Re: [ensembl-dev] VEP result does not match start-end</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span class="Apple-tab-span" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: pre; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;"></span><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">coordinate
and allele for hgvs syntax</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">To:<span class="Apple-converted-space"> </span></span><a href="mailto:dev@ensembl.org" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">dev@ensembl.org</a><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Message-ID:
<</span><a href="mailto:1cdd0a5c-bd3e-5acf-ffa4-0e3847a80cd8@ebi.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">1cdd0a5c-bd3e-5acf-ffa4-0e3847a80cd8@ebi.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Content-Type:
text/plain; charset="windows-1252"; Format="flowed"</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Hi
Bhavana,</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Thanks
for reporting this one - you have discovered a bug in our HGVS<span class="Apple-converted-space"> </span></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">parsing
of longer variants. This is now fixed in the release/85<span class="Apple-converted-space"> </span></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">variation
API, so if you use command line VEP, you could pick up the<span class="Apple-converted-space"> </span></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">update.
We are in the late stages of preparing for our next release<span class="Apple-converted-space"> </span></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">which
is due at the end of the month, so our REST and web servers will<span class="Apple-converted-space"> </span></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">be
updated then.</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Best
wishes,</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Sarah</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">On
19/09/2016 10:34, Bhavana Harsha wrote:</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<blockquote type="cite" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
Hi Daniel,<br class="">
<br class="">
Thank you for this. It works on VEP REST when I reverse the coordinates.<br class="">
But from what I know reversing the coordinates is not compliant with<span class="Apple-converted-space"> </span><br class="">
the HGVS notation rules (i.e. the positions should be listed 5? to 3?).<br class="">
<br class="">
Besides, one of the results from Ensembl VEP (with input<span class="Apple-converted-space"> </span><br class="">
c.783_661+1del124) is again:<br class="">
<br class="">
ENST00000460680.1:c.*661_783+1*delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG<br class="">
<br class="">
As far as I know, VEP returns HGVS compliant syntax. So, should it not<span class="Apple-converted-space"> </span><br class="">
also accept the same as input?<br class="">
<br class="">
Cheers,<br class="">
Bhavana<br class="">
<br class="">
<br class="">
<blockquote type="cite" class="">HI Bhavana,<br class="">
<br class="">
I think the transcript is on the -1 strand so the start/end<span class="Apple-converted-space"> </span><br class="">
coordinates have to be swapped.<br class="">
<a href="http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.783_661+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1" class="">http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.783_661+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1</a><br class="">
<br class="">
But that's just a guess.<br class="">
Best,<br class="">
Daniel<br class="">
<br class="">
<blockquote type="cite" class="">From: <<a href="mailto:dev-bounces@ensembl.org" class="">dev-bounces@ensembl.org</a><<a href="mailto:dev-bounces@ensembl.org" class="">mailto:dev-bounces@ensembl.org</a>>> on<span class="Apple-converted-space"> </span><br class="">
behalf of Bhavana Harsha <<a href="mailto:bh4@sanger.ac.uk" class="">bh4@sanger.ac.uk</a><<a href="mailto:bh4@sanger.ac.uk" class="">mailto:bh4@sanger.ac.uk</a>>><br class="">
Reply-To: Ensembl developers list<span class="Apple-converted-space"> </span><br class="">
<<a href="mailto:dev@ensembl.org" class="">dev@ensembl.org</a><<a href="mailto:dev@ensembl.org" class="">mailto:dev@ensembl.org</a>>><br class="">
Date: Friday, September 16, 2016 at 3:40 PM<br class="">
To: "<a href="mailto:dev@ensembl.org" class="">dev@ensembl.org</a><<a href="mailto:dev@ensembl.org" class="">mailto:dev@ensembl.org</a>>"<span class="Apple-converted-space"> </span><br class="">
<<a href="mailto:dev@ensembl.org" class="">dev@ensembl.org</a><<a href="mailto:dev@ensembl.org" class="">mailto:dev@ensembl.org</a>>><br class="">
Subject: [ensembl-dev] VEP result does not match start-end<span class="Apple-converted-space"> </span><br class="">
coordinate and allele for hgvs syntax<br class="">
<br class="">
Hello,<br class="">
<br class="">
We?re trying to validate some mutations and see other co-located<span class="Apple-converted-space"> </span><br class="">
variants by using the VEP REST service for GRCh37, like this:<br class="">
<br class="">
<a href="http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1" class="">http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1</a><br class="">
<br class="">
And I get the following error:<br class="">
{?error":"Start (52440390) must be less than or equal to end+1<span class="Apple-converted-space"> </span><br class="">
(52440270)"}<br class="">
<br class="">
<br class="">
If I include the deleted sequence in the hgvs syntax, I get a<span class="Apple-converted-space"> </span><br class="">
different error:<br class="">
<br class="">
Input:<br class="">
<a href="http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG?content-type=application/json;canonical=1&ccds=1&hgvs=1" class="">http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG?content-type=application/json;canonical=1&ccds=1&hgvs=1</a><br class="">
<br class="">
Output:<br class="">
{?error":"Reference allele extracted from<span class="Apple-converted-space"> </span><br class="">
ENST00000460680:52440390-52440269 (AGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAG)<span class="Apple-converted-space"> </span><br class="">
does not match reference allele given by HGVS<span class="Apple-converted-space"> </span><br class="">
notation ENST00000460680.1:c.661_783+1delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG<span class="Apple-converted-space"> </span><br class="">
(GAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG)"}<br class="">
<br class="">
<br class="">
This is strange because shouldn?t the transcript coordinates<span class="Apple-converted-space"> </span><br class="">
?ENST00000460680.1:c.661-783+1? correspond to<span class="Apple-converted-space"> </span><br class="">
?3:g.52440268-52440391?? But these aren?t the coordinates returned<span class="Apple-converted-space"> </span><br class="">
and the allele sequence is inconsistent with the input.<br class="">
<br class="">
Is there something I?m missing here?<br class="">
<br class="">
Cheers,<br class="">
Bhavana<br class="">
<br class="">
<br class="">
---------------------------------------------<br class="">
Bhavana Harsha<br class="">
Bioinformatician<br class="">
COSMIC<br class="">
Wellcome Trust Sanger Institute<br class="">
Hinxton, UK<br class="">
CB10 1SA<br class="">
</blockquote>
</blockquote>
</blockquote>
<br class="Apple-interchange-newline">
</div>
</blockquote>
</div>
<br class="">
</div>
</body>
</html>