<html>
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8">
</head>
<body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space;" class="">
Hi Will,
<div class=""><br class="">
</div>
<div class="">Thank you for looking into this.</div>
<div class="">You’re right, I do get the correct AA syntax with release 89.</div>
<div class=""><br class="">
</div>
<div class="">I had tried to switch my git branches from an older version to 89, it must not have worked correctly. It worked when I did a fresh clone of the git repos. Sorry, my bad!</div>
<div class=""><br class="">
</div>
<div class="">Cheers,</div>
<div class="">Bhavana</div>
<div class=""><br class="">
</div>
<div class=""><br class="">
<div>
<blockquote type="cite" class="">
<div class="">On 13 Jul 2017, at 12:00, <a href="mailto:dev-request@ensembl.org" class="">
dev-request@ensembl.org</a> wrote:</div>
<br class="Apple-interchange-newline">
<div class=""><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Message:
1</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Date:
Wed, 12 Jul 2017 12:44:53 +0100</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">From:
William McLaren <</span><a href="mailto:wm2@ebi.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">wm2@ebi.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">To:
Ensembl developers list <</span><a href="mailto:dev@ensembl.org" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">dev@ensembl.org</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Subject:
Re: [ensembl-dev] Fwd: Possible bug in variation API - result</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span class="Apple-tab-span" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: pre; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;"></span><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">different
from VEP</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Message-ID:
<</span><a href="mailto:etPan.59660bb5.559a1909.ab7b@ebi.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">etPan.59660bb5.559a1909.ab7b@ebi.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Content-Type:
text/plain; charset="utf-8"</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Hi
Bhavana,</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">I?m
unable to replicate this issue. I?ve run your code (slightly modified to dump out the results, exact code at the end of this mail), and this is the result I see:</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">$VAR1
= [</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000352610.4:p.Ala307ThrfsTer41',</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000269305.4:p.Ala307ThrfsTer34',</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000398846.2:p.Ala307ThrfsTer32',</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000391127.2:p.Ala307ThrfsTer40',</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000391478.2:p.Ala307ThrfsTer34',</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">?
'ENSP00000425104.1:p.Ala175ThrfsTer?'</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">];</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Double
check that your API (both ensembl and ensembl-variation) is up to date for release/89.</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Regards</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Will
McLaren</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Ensembl
Variation</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">###</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">use
Bio::EnsEMBL::Registry;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$reg = 'Bio::EnsEMBL::Registry';</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">$reg->load_registry_from_db(-host
=> '</span><a href="http://ensembldb.ensembl.org/" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">ensembldb.ensembl.org</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">',
-species => 'homo sapiens', -user => 'anonymous', -port => 3337, -db_version => 89);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$sa = $reg->get_adaptor('human', 'core', 'slice');</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$vfa = $reg->get_adaptor('human', 'variation', 'VariationFeature');</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$slice = $sa->fetch_by_region('chromosome', 17);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$vf = Bio::EnsEMBL::Variation::VariationFeature->new(-start => 7576915, -end => 7577019, -slice => $slice,</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">-allele_string
=> 'TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-', -strand => 1, -adaptor => $vfa);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$cons = $vf->get_all_TranscriptVariations;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
@hgvsp = grep { defined } map { $_->hgvs_protein } map { @{$_->get_all_alternate_TranscriptVariationAlleles} } @$cons;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">use
Data::Dumper;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">$Data::Dumper::Maxdepth
= 3;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">$Data::Dumper::Indent
= 1;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">print
STDERR Dumper \@hgvsp;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">On
11 July 2017 at 15:24:39, Bhavana Harsha (</span><a href="mailto:bh4@sanger.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">bh4@sanger.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">)
wrote:</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">I
forgot to mention that these are GRCh37 coordinates.</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Bhavana</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Begin
forwarded message:</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">From:
Bhavana Harsha <</span><a href="mailto:bh4@sanger.ac.uk" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">bh4@sanger.ac.uk</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">></span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Subject:
Possible bug in variation API - result different from VEP</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Date:
11 July 2017 at 14:17:20 BST</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">To:<span class="Apple-converted-space"> </span></span><a href="mailto:dev@ensembl.org" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">dev@ensembl.org</a><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Hello,?</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">For
the following variant</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">17
75769157577019 TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-+</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">the
correct protein consequence for the transcript ENST00000269305 should be?</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">ENSP00000269305.4:p.Ala307ThrfsTer34</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">As
is confirmed by the VEP web interface, REST API and the VEP perl script.</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">However,
when I try to get this using the Variation API, I get</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">ENSP00000269305.4:p.Ala307Thr</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">This
is how I?m using the API:</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">$reg->load_registry_from_db(-host
=> '</span><a href="http://ensembldb.ensembl.org/" style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">ensembldb.ensembl.org</a><span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">',
-species => 'homo sapiens', -user => 'anonymous', -port => 3337);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$sa = $reg->get_adaptor(?human?, 'core', 'slice');</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$vfa = $reg->get_adaptor('human', 'variation', 'VariationFeature');</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$slice = $sa->fetch_by_region(?chromosome', 17);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$vf = Bio::EnsEMBL::Variation::VariationFeature->new(-start => 7576915,?-end => 7577019,?-slice => $slice,?</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">-allele_string
=> ?TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-?,?-strand => 1,?-adaptor => $vfa);</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
$cons = $vf->get_all_TranscriptVariations;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">my
@hgvsp = grep { defined } map { $_->hgvs_protein } map { @{$_->get_all_alternate_TranscriptVariationAlleles} } @$cons;</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">I?m
using v89 for the API and the VEP script.</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Is
there something I?m doing wrong in my script?</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Cheers,</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Bhavana</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">---------------------------------------------</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Bhavana
Harsha</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Bioinformatician</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">COSMIC</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Wellcome
Trust Sanger Institute</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">Hinxton,
UK</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<span style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px; float: none; display: inline !important;" class="">CB10
1SA</span><br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
<br style="font-family: Helvetica; font-size: 12px; font-style: normal; font-variant-caps: normal; font-weight: normal; letter-spacing: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px; -webkit-text-stroke-width: 0px;" class="">
</div>
</blockquote>
</div>
<br class="">
</div>
</body>
</html>